Skip to content Skip to navigation

Connexions

You are here: Home » Content » PipMaker

Navigation

Content Actions

  • Download module PDF
  • Add to ...
    Add the module to:
    • My Favorites
    • A lens
    • An external social bookmarking service
    • My Favorites (What is 'My Favorites'?)
      'My Favorites' is a special kind of lens which you can use to bookmark modules and collections directly in Connexions. 'My Favorites' can only be seen by you, and collections saved in 'My Favorites' can remember the last module you were on. You need a Connexions account to use 'My Favorites'.
    • A lens (What is a lens?)

      Definition of a lens

      Lenses

      A lens is a custom view of Connexions content. You can think of it as a fancy kind of list that will let you see Connexions through the eyes of organizations and people you trust.

      What is in a lens?

      Lens makers point to Connexions materials (modules and collections), creating a guide that includes their own comments and descriptive tags about the content.

      Who can create a lens?

      Any individual Connexions member, a community, or a respected organization.

      What are tags? tag icon

      Tags are descriptors added by lens makers to help label content, attaching a vocabulary that is meaningful in the context of the lens.

    • External bookmarks
  • E-mail the author
  • Rate this module (How does the rating system work?)

    Rating system

    Ratings

    Ratings allow you to judge the quality of modules. If other users have ranked the module then its average rating is displayed below. Ratings are calculated on a scale from one star (Poor) to five stars (Excellent).

    How to rate a module

    Hover over the star that corresponds to the rating you wish to assign. Click on the star to add your rating. Your rating should be based on the quality of the content. You must have an account and be logged in to rate content.

    (0 ratings)

Recently Viewed

This feature requires Javascript to be enabled.

PipMaker

Module by: Susan Cates

Summary: This module is an introduction to the pip, or percent identity plot. The PipMaker tool available through the Penn State Bioinformatics Group web site is used to create a pip using sample reference and query sequences.

Note: Your browser may not currently support MathML. See our browser support page for additional details. You can always view the correct math in the PDF version.

A useful graphical tool for viewing sequence alignments, particulary within the genome context, is the percent identity plot, called a pip for short. PipMaker (1) is a web server that will perform a sequence alignment on two long DNA segments and produce a pip in pdf format and email the results to the user. Exons of genes and repetitive elements can be labeled along the horizontal axis of the reference DNA sequence, and some coloring options are available for the advanced pip user to clarify and enhance their display. A dot plot is included in the results, illustrating the locations of the query sequence segments in comparison to the reference sequence.

View the PipMaker Home Page. Read the introductory information on this page, then click on the link "PipMaker Instructions" and read the section entitled "Overview". PipMaker requires that the user submit two sequences, and gives the option of submitting additional information. The reference sequence is submitted first, in FASTA format. This is the sequence that will be depicted along the horizontal axis. The query sequence must be provided second. A mask file containing repeat sequences can be submitted; the user generates this file using the RepeatMasker tool, also provided on this web site. The repeats in the mask file are indicated in the plot by various kinds of triangles. Additionally, gene and exon positions can be input by the user, for labeling the locations of exons within their respective genes in the plot. CpG (cytosine-phosphate-guanine) islands in the first sequence are independently determined by PipMaker and are shown as low boxes at the top of the graphical display.

Take a look at the example plot shown on the "Instructions" page. The vertical axis of the plot is the percent identity, ranging from 50% to 100%. Identities below 50% will not be plotted. The current version of PipMaker compares the first sequence with both the second sequence and its reverse complement, so matching regions need not occur in the same orientations and relative positions in the two sequences. Read the section entitled "Input to PipMaker" and become acquainted with the format of the different input options. Return to this instruction page later for help interpreting the output that PipMaker produces, if necessary.

Use your browser's back button to return to the PipMaker Home Page. Click on the PipMaker link, located just below the phrase "The application itself can be found here:". This example will use a section of the sequence from human chromosome 11 as the reference sequence, and an EST query sequence. In the box labeled "First sequence", paste in the following reference sequence:

>Sequence from homo sapiens chromosome 11 Sequence from homo sapiens chromosome 11


GAGGACGTGGCTGGGCTCGTGAAGCATGTGGGGGTGAGCCCAGGGGCCCC  
AAGGCAGGGCACCTGGCCTTCAGCCTGCCTCAGCCCTGCCTGTCTCCCAG  
ATCACTGTCCTTCTGCCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTG  
GCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCA  
ACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGG  
AACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTG  
CAGGGTGAGCCAACTGCCCATTGCTGCCCCTGGCCGCCCCCAGCCACCCC  
CTGCTCCTGGCGCTCCCACCCAGCATGGGCAGAAGGGGGCAGGAGGCTGC  
CACCCAGCAGGGGGTCAGGTGCACTTTTTTAAAAAGAAGTTCTCTTGGTC  
ACGTCCTAAAAGTGACCAGCTCCCTGTGGCCCAGTCAGAATCTCAGCCTG  
AGGACGGTGTTGGCTTCGGCAGCCCCGAGATACATCAGAGGGTGGGCACG  
CTCCTCCCTCCACTCGCCCCTCAAACAAATGCCCCGCAGCCCATTTCTCC  
ACCCTCATTTGATGACCGCAGATTCAAGTGTTTTGTTAAGTAAAGTCCTG  
GGTGACCTGGGGTCACAGGGTGCCCCACGCTGCCTGCCTCTGGGCGAACA  
CCCCATCACGCCCGGAGGAGGGCGTGGCTGCCTGCCTGAGTGGGCCAGAC  
CCCTGTCGCCAGGCCTCACGGCAGCTCCATAGTCAGGAGATGGGGAAGAT  
GCTGGGGACAGGCCCTGGGGAGAAGTACTGGGATCACCTGTTCAGGCTCC  
CACTGTGACGCTGCCCCGGGGCGGGGGAAGGAGGTGGGACATGTGGGCGT  
TGGGGCCTGTAGGTCCACACCCAGTGTGGGTGACCCTCCCTCTAACCTGG  
GTCCAGCCCGGCTGGAGATGGGTGGGAGTGCGACCTAGGGCTGGCGGGCA  
GGCGGGCACTGTGTCTCCCTGACTGTGTCCTCCTGTGTCCCTCTGCCTCG  
CCGCTGTTCCGGAACCTGCTCTGCGCGGCACGTCCTGGCAGTGGGGCAGG  
TGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTG  
GAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCAT  
CTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCCGCAG  
GCAGCCCCACACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCC  
TTGAACCAGCCCTGCTGTGCCGTCTGTGTGTCTTGGGGGCCCTGGGCCAA  
GCCCCACTTCCCGGCACTGTTGTGAGCCCCTCCCAGCTCTCTCCACGCTCTCTGGGT

In the box labeled "Second sequence", paste in the following query sequence:


TCAAGCAGATCACTGTCCTTCTGCCATGGCCCTGT
GGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCC
CTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAA
CCAACACCTGTGCGGCTCACACCTGGTGGAAGCTC
TCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTAC
ACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCA
GGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTG
CAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCC
CTGCAGAAGCGTGGCATTGTGGAACAATGCTGTAC
CAGCATCTGCTCCCTCTACCAGCTGGAGAACTACT
GCAACTAGACGCAGCCCGCATGCAGNCCCCCACCC
GCCGNCTTCTGCACCGAGAGAGATGGAATTAAACC
CTTGAACCCAGCANANAAAAAAAAGAAATAAAA

Next, supply an email address in the appropriate box, so that PipMaker can email the results. The box entitled "First sequence mask" will be left empty for this example. In fact, if the reference sequence is submitted to RepeatMasker, it responds that there are no repeats detected in this sequence. Feel free to try this, there is a link to RepeatMasker on the PipMaker Instruction page. In the box entitled "First sequence exons", paste in the following information, which specifies exons that correspond roughly to the Genescan Gene Predictions for the reference sequence (these were illustrated in BLAT in a previous module).

<100 1307 PUTATIVE INSULIN PRECURSOR 100 1307 PUTATIVE INSULIN PRECURSOR


100 304
1091 1307
    

Now, click on the submit button. Pipmaker will email several documents to you, two of which will be a "pip.pdf" and a "dot.pdf". View both of these figures (you may need to zoom in).

Exercise 1

What do you estimate the percent identities to be between (a) the query subsequence under Exon 1 and the reference subsequence, and (b) the query subsequence under Exon 2 and the reference subsequence?

Exercise 2

Which sequence is represented by the vertical axis of the dot plot, the query sequence (the EST) or the reference sequence (from chromosome 11)?

Pipmaker was designed to be used with sequences that can be much longer than these examples. Look under the input to PipMaker section of the "PipMaker Instructions" page.

Exercise 3

What is the maximum allowed length for the first (reference) sequence file?

Exercise 4

Is this the same as the maximum allowed length for the second (query) sequence file?

Feel free to try the PipMaker tool with other sets of related sequences. The PipMaker home page provides a set of advanced instructions for those who will be using this tool frequently for publications and reports.

References

  1. Schwartz et al. (2000). PipMaker-A Web Server for Aligning Two Genomic DNA Sequences. Genome Research, 10:577-586.

Comments, questions, feedback, criticisms?

Send feedback