- Content Actions
- Download PDF
- Save to del.icio.us (?)Add this content to the social bookmarking site del.icio.us, where you can share your favorite links with others.
- Lenses
LensesA lens is a custom view of Connexions content. You can think of it as a fancy kind of list that will let you see Connexions through the eyes of organizations and people you trust.
What is in a lens?Lens makers point to Connexions materials (modules and collections), creating a guide that includes their own comments and descriptive tags about the content.
Who can create a lens?Any individual Connexions member, a community, or a respected organization.
This content is ...
Affiliated with (?)
This content is either by members of the organizations listed or about topics related to the organizations listed. Click each link to see a list of all content affiliated with the organization.- Rice University OCW
This module is included inLens: Rice University OpenCourseWare
By: OpenCourseWare ConsortiumAs a part of collection:"Bios 533 Bioinformatics"Click the "Rice University OCW" link to see all content affiliated with them.
PipMaker
Summary: This module is an introduction to the pip, or percent identity plot. The PipMaker tool available through the Penn State Bioinformatics Group web site is used to create a pip using sample reference and query sequences.
A useful graphical tool for viewing sequence alignments, particulary within the genome context, is the percent identity plot, called a pip for short.
PipMaker (1)
is a web server that will perform a sequence alignment on two long DNA segments
and produce a pip in pdf format and email the results to the user.
Exons of genes and repetitive elements can be labeled along the horizontal axis
of the reference DNA sequence, and some coloring options are available for the
advanced pip user to clarify and enhance their display. A dot plot is included
in the results, illustrating the locations of the query sequence segments in
comparison to the reference sequence.
View the PipMaker Home Page.
Read the introductory information on this page,
then click on the link "PipMaker Instructions"
and read the section entitled "Overview".
PipMaker requires that the user submit two sequences,
and gives the option of submitting additional information.
The reference sequence is submitted first, in FASTA format.
This is the sequence that will be depicted along the horizontal axis.
The query sequence must be provided second.
A mask file containing repeat sequences can be submitted;
the user generates this file using the RepeatMasker tool,
also provided on this web site. The repeats in the mask file are indicated
in the plot by various kinds of triangles. Additionally, gene and exon
positions can be input by the user, for labeling the locations of exons
within their respective genes in the plot.
CpG (cytosine-phosphate-guanine) islands in the first
sequence are independently determined by PipMaker and are shown as low boxes
at the top of the graphical display.
Take a look at the example plot shown on the "Instructions" page.
The vertical axis of the plot is the percent identity, ranging from 50% to 100%.
Identities below 50% will not be plotted. The current version of PipMaker
compares the first sequence with both the second sequence and its reverse
complement, so matching regions need not occur in the same orientations and
relative positions in the two sequences. Read the section entitled "Input to
PipMaker" and become acquainted with the format of the different input options.
Return to this instruction page later for help interpreting the output that PipMaker produces, if necessary.
Use your browser's back button to return to the PipMaker Home Page.
Click on the PipMaker link, located just below the phrase
"The application itself can be found here:". This example will use a
section of the sequence from human chromosome 11 as the reference sequence, and
an EST query sequence. In the box labeled "First sequence", paste in the
following reference sequence:
GAGGACGTGGCTGGGCTCGTGAAGCATGTGGGGGTGAGCCCAGGGGCCCC AAGGCAGGGCACCTGGCCTTCAGCCTGCCTCAGCCCTGCCTGTCTCCCAG ATCACTGTCCTTCTGCCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTG GCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCA ACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGG AACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTG CAGGGTGAGCCAACTGCCCATTGCTGCCCCTGGCCGCCCCCAGCCACCCC CTGCTCCTGGCGCTCCCACCCAGCATGGGCAGAAGGGGGCAGGAGGCTGC CACCCAGCAGGGGGTCAGGTGCACTTTTTTAAAAAGAAGTTCTCTTGGTC ACGTCCTAAAAGTGACCAGCTCCCTGTGGCCCAGTCAGAATCTCAGCCTG AGGACGGTGTTGGCTTCGGCAGCCCCGAGATACATCAGAGGGTGGGCACG CTCCTCCCTCCACTCGCCCCTCAAACAAATGCCCCGCAGCCCATTTCTCC ACCCTCATTTGATGACCGCAGATTCAAGTGTTTTGTTAAGTAAAGTCCTG GGTGACCTGGGGTCACAGGGTGCCCCACGCTGCCTGCCTCTGGGCGAACA CCCCATCACGCCCGGAGGAGGGCGTGGCTGCCTGCCTGAGTGGGCCAGAC CCCTGTCGCCAGGCCTCACGGCAGCTCCATAGTCAGGAGATGGGGAAGAT GCTGGGGACAGGCCCTGGGGAGAAGTACTGGGATCACCTGTTCAGGCTCC CACTGTGACGCTGCCCCGGGGCGGGGGAAGGAGGTGGGACATGTGGGCGT TGGGGCCTGTAGGTCCACACCCAGTGTGGGTGACCCTCCCTCTAACCTGG GTCCAGCCCGGCTGGAGATGGGTGGGAGTGCGACCTAGGGCTGGCGGGCA GGCGGGCACTGTGTCTCCCTGACTGTGTCCTCCTGTGTCCCTCTGCCTCG CCGCTGTTCCGGAACCTGCTCTGCGCGGCACGTCCTGGCAGTGGGGCAGG TGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTG GAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCAT CTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCCGCAG GCAGCCCCACACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCC TTGAACCAGCCCTGCTGTGCCGTCTGTGTGTCTTGGGGGCCCTGGGCCAA GCCCCACTTCCCGGCACTGTTGTGAGCCCCTCCCAGCTCTCTCCACGCTCTCTGGGT
In the box labeled "Second sequence", paste in the following query sequence:
TCAAGCAGATCACTGTCCTTCTGCCATGGCCCTGT GGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCC CTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAA CCAACACCTGTGCGGCTCACACCTGGTGGAAGCTC TCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTAC ACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCA GGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTG CAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCC CTGCAGAAGCGTGGCATTGTGGAACAATGCTGTAC CAGCATCTGCTCCCTCTACCAGCTGGAGAACTACT GCAACTAGACGCAGCCCGCATGCAGNCCCCCACCC GCCGNCTTCTGCACCGAGAGAGATGGAATTAAACC CTTGAACCCAGCANANAAAAAAAAGAAATAAAA
Next, supply an email address in the appropriate box, so that PipMaker can email the results. The box entitled "First sequence mask" will be left empty for this example. In fact, if the reference sequence is submitted to RepeatMasker, it responds that there are no repeats detected in this sequence. Feel free to try this, there is a link to RepeatMasker on the PipMaker Instruction page. In the box entitled "First sequence exons", paste in the following information, which specifies exons that correspond roughly to the Genescan Gene Predictions for the reference sequence (these were illustrated in BLAT in a previous module).
100 304
1091 1307
Now, click on the submit button. Pipmaker will email several documents to you,
two of which will be a "pip.pdf" and a "dot.pdf". View both of these figures
(you may need to zoom in).
Problem 1
What do you estimate the percent identities
to be between (a) the query subsequence under Exon 1 and the reference
subsequence, and (b) the query subsequence under Exon 2 and the
reference subsequence?
Problem 2
Which sequence is represented by the vertical axis of
the dot plot, the query sequence (the EST) or the reference sequence
(from chromosome 11)?
Pipmaker was designed to be used with sequences that can be much longer than
these examples. Look under the input to PipMaker section of the "PipMaker
Instructions" page.
Problem 3
What is the maximum allowed length for the first
(reference) sequence file?
Problem 4
Is this the same as the maximum allowed
length for the second (query) sequence file?
Feel free to try the PipMaker tool with other sets of related sequences.
The PipMaker home page provides a set of advanced instructions for those who
will be using this tool frequently for publications and reports.
More about this content: Metadata | Version History | Cite This Content
This work is licensed by Susan Cates. See the Creative Commons License about permission to reuse this material.
Last edited by Susan Cates on Jan 24, 2005 2:02 pm US/Central.